Genetic resources

Find a PlasmoGEM vector

PlasmoGEM gene targeting vectors

For the vast majority of PlasmoGEM vectors, lambda red recombination and Gateway technology were combined to convert genomic libraries into gene targeting vectors with long homology arms, which integrate with high efficiency (Pfander et al., 2011). A smaller number of vectors were later constructed using Gibson assembly of 3 kb homology arms to produce functionally equivalent barcoded vectors that close some of the gaps in the P. berghei resource (publication in preparation).

All PlasmoGEM vectors are equipped with sequence-readable barcodes, and we use barcode-sequencing (BarSeq) for high-throughput parallel growth phenotyping of mutants (method in Gomes et al., 2015).

The first step in the recombineering pipeline produces an intermediate vector in which a zeo-PheS bacterial resistance marker is inserted into the coding sequence (gene knock-out) or 3'UTR (c-terminal tagging) of the target locus. The process is completed by a Gateway-mediated exchange of the zeo-PheS cassette for an hdhfr-yfcu parasite selectable marker.

Two types of gene targeting vectors are currently available from PlasmoGEM:

  • Gene knock-out (complete or partial deletion) vectors.
  • C-terminal epitope tagging vectors.

Final and intermediate vectors can be requested:

  • Final vectors are quality controlled and ready to be prepped for P. berghei transfection.
  • Intermediate vectors allow the user to replace the zeo-PheS marker with an alternative selection cassette, containing for instance a reporter gene or an alternative 3'-tag. A protocol for doing this is available in the protocol guide.
  • Alternative Gateway cassettes are available for different fluorescent tags including mCherry, iLOV, eGFP, eMERALD and mVenus.

Primers for PlasmoGEM vectors

PlasmoGEM vector (recombineering) primers

PlasmoGEM vectors are made by recombineering and each vector design is associated with a recombineering primer pair (RecUp and RecDown) with each primer consisting of:

  • 50 bp oligonucleotide sequences homologous to the targeting region of the gene of interest.
  • 20 bp oligonucleotide sequences annealing to the zeo-pheS bacterial selection marker.

These are designated "R1" and "R2": The names refer to the attR1 and attR2 sites of the selection cassette and determines the orientation of the resistance marker in the final construct.

  • Tagging designs always use the "RecUpR1/RecDownR2" orientation.
  • Knock-out designs can also use "RecUpR1/RecDownR2", but the preferred orientation is "RecUpR2/RecDownR1", which inserts the selection marker in reverse orientation to the target gene.
  • 11 bp gene-specific molecular barcode and 18 bp annealing site for barcode amplification primer (RecDown only).

There are also a set of diagnostic or quality control primers for each construct:

  • In KO constructs, primer QCR1 (quality control R1) anneals between recUp and recDown in the region of the genome that will be substituted for the selection cassette.
  • In 3' tagging designs QCR1 anneals upstream of the recUp primer.
  • QCR2 (quality control R2): anneals downstream of recDown.
  • GT (genotyping): Anneals up- or downstream of PbG clone homology region.

Together, QCR1 and QCR2 can be used to detect the wt locus.

Verification of insertion of the hdhfr/yfcu selection cassette into the correct location (modified target locus) of your vector can be done by using a combination of the QCR2 and GW2 primers.

QCR2 and GW2 can be used to verify a vector by PCR and to detect the integrated and unintegrated vector in a transfectant parasite population.

For genotyping by long-range PCR, the gene-specific GT primer can be used together with the generic primer GW2 or GW1 (integration PCR), depending on positioning and direction of the GT primer.

GW1 and GW2 are static (do not depend on individual design). Their sequences are:

  • GW1 primer: 5'-catactagccattttatgtg-3'
  • GW2 primer: 5'-ctttggtgacagatactac-3'

Barcode sequencing (barseq) primers

All PlasmoGEM vectors are equipped with an 11 bp unique molecular barcode that can be used to identify and quantify parasites in a mixed pool of mutants by barcode sequencing (barseq).

The 11 bp variable barcode can be amplified by the barcode amplicon (BA) primer pair:

  • BA primer: 5'GTAATTCGTGCGCGTCAG
  • BA2 primer: 5'CCTTCAATTTCGATGGGTAC

Sequencing libraries from pools of barcoded mutants can be generated by a nested PCR approach using the method described in Gomes et al. 2015. The PCR primer sequences are available as an Excel file.